Question 293 MCQ · 1.0 marks
What does the action set represents?
The city Ramu should visit next in a stage
The beginning city in every stages
Distance covered upto a given stage
A published solution is not available for this question yet.
Big Data and Biological Networks · Quiz 2 · Jan 2025
Big Data and Biological Networks · Quiz 2 · Jan 2025
← Course papers · Start practice / exam
Questions and published explanations below are available without starting a test. Some questions may not have a published solution yet.
0 / 24 published solutions
Question 294 NAT · 2.0 marks
What is the objective function value in Stage-2?
A published solution is not available for this question yet.
Question 296 MCQ · 2.0 marks
What happens to scale-free networks when subjected to random node removal?
The network disintegrates rapidly
The diameter and characteristic path length decrease significantly
The network remains largely insensitive to the perturbation
The diameter and characteristic path length increase significantly
A published solution is not available for this question yet.
Question 297 MCQ · 2.0 marks
Consider a regular lattice with n = 7 and m = 14. The number of triangular sub-graphs in the given
network is
70
35
140
360
A published solution is not available for this question yet.
Question 298 MCQ · 2.0 marks
Consider the following set of metabolic reactions:
R1: P + Q → 2R
R2: 2Q + S → T
R3: R + T → 3U
R4: P + U → V + S
What is the density of the undirected substrate graph formed?
0.33
0.56
0.27
0.73
A published solution is not available for this question yet.
Question 299 MCQ · 2.0 marks
If a metabolite with high betweenness centrality is knocked out, what is the likely consequence?
Pathway redundancy increases, paradoxically making the metabolic network
more resilient.
The network always compensates through alternative routes, ensuring no
functional loss.
Metabolic pathways may become fragmented, potentially disrupting essential
biochemical functions.
Only directly connected reactions are affected, while the overall network
remains stable.
A published solution is not available for this question yet.
Question 300 MCQ · 2.0 marks
What is the average degree (regardless of the direction) of the 3-mer De-Bruijn graph constructed
from “TCAGAGGT”?
4.1
2.4
3.4
2
A published solution is not available for this question yet.
Question 301 MCQ · 2.0 marks
What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained
from “ATCGGTACAACTCTCTCATGCG”?
15
14
19
17
A published solution is not available for this question yet.
Question 302 MSQ · 3.0 marks
A researcher is studying network motifs in a biological network and generates randomized
networks for comparison. Which of the following statements are correct regarding the
randomization process?
Randomized networks must ideally retain the same number of nodes and
edges as the original network.
Randomized networks can have a different degree distribution to ensure
statistical significance.
Randomized networks can be generated using the configuration model, to
ensure that the degree sequence of the original network is preserved.
Randomized networks can be generated by randomly adding new nodes and
edges.
A published solution is not available for this question yet.
Question 303 MSQ · 3.0 marks
The Girvan–Newman algorithm for community detection involves which of the following steps?
Remove edges with the highest betweenness first.
Re-compute the betweenness after each edge removal.
Remove edges with the lowest betweenness first.
Remove nodes with the lowest betweenness first.
A published solution is not available for this question yet.
Question 304 MSQ · 3.0 marks
A researcher is modeling the spread of an infectious disease on a small-world network. Which of
the following are true in the context of the likelihood of a disease outbreak?
The diameter of the network is an important factor, as it influences how
quickly the disease can reach distant nodes.
The clustering coefficient is one of the parameters that determine the
likelihood of localized outbreaks.
The degree distribution has no impact on disease spread in small-world
networks.
The transmissibility of the disease is independent of the network structure.
A published solution is not available for this question yet.
Question 305 MSQ · 3.0 marks
Which of these are challenges one might encounter in the process of genome assembly?
Erroneous reads
Large volumes of data
Duplicate sequences
Incomplete graph
A published solution is not available for this question yet.
Question 306 MSQ · 3.0 marks
Consider the following two statements:
a. **Statement 1:** Reads from the genome sequencing are prone to error.
b. **Statement 2:** Sequence alignment can be used to overcome this problem.
Based on your observations, which of the following statements is not true?
Both statements are true and statement 2 is a potential solution for statement
1
Both statements are true but statement 2 is not a solution to statement 1
Both statements are false
Statement 1 is false but Statement 2 is true
A published solution is not available for this question yet.
Question 307 MSQ · 2.0 marks
Microbe ‘M’ has 50 reactions that are stuck when grown by itself. When ‘M’ is grown with ‘N’, the
stuck reactions reduce to 40. When ‘M’ is paired with ‘O’, the number drops to 42. Which of the
following statements hold true?
MSI of ‘M’ in the presence of ‘N’ is 0.2.
MSI of ‘M’ in the presence of ‘O’ is 0.16.
MSI of ‘M’ in the presence of ‘N’ and ‘O’ is 0.36.
MSI of ‘N’ in the presence of ‘M’ is 0.2.
A published solution is not available for this question yet.
Question 308 MSQ · 2.0 marks
Gene 1 → Gene 2
Gene 1 → Gene 3
Gene 3 → Gene 2
Gene 3 → Gene 1
A published solution is not available for this question yet.
Question 309 MSQ · 2.0 marks
How are network motifs related to the organization of gene regulatory networks?
They represent common patterns of gene regulation that appear frequently in
the network
They can be interconnected to form modules, which can regulate specific gene
sets
They are not relevant at all levels of regulatory networks
They are always independent of the modules in the network
A published solution is not available for this question yet.
Question 310 MSQ · 2.0 marks
Which of the following are true about feed-forward loop (FFL) motifs in transcriptional regulatory
networks?
FFLs are simple sequences of gene interactions with no regulation involved.
FFLs can involve both positive and negative regulation, which helps control
gene expression in a dynamic manner.
FFLs are mainly found in eukaryotic organisms and are not present in
prokaryotes.
In an FFL, feedback can either increase (amplify) or decrease (attenuate) the
gene expression signal.
A published solution is not available for this question yet.
Question 311 MSQ · 2.0 marks
Consider a graph that was constructed by comparing n DNA sequences. If the two sequences can
be aligned with a score greater than a threshold value, we assign an edge between the two in the
graph. Given this, which of the following is true:
Inserting a new node to the graph requires n comparisons
Inserting a new node is a node level task
If all the alignments have the same score, the resultant graph is a complete
graph
There will be two connected components in the resultant graph
A published solution is not available for this question yet.
Question 312 MSQ · 2.0 marks
Which of the following does not makes an appropriate pair?
Node classification – Predicting drug-drug interaction
Graph classification – Predicting toxicity of a chemical compound
Link Prediction – Predicting function of novel proteins
Graph regression – Predicting free energy of hydration
A published solution is not available for this question yet.
Question 313 MCQ · 1.0 marks
How many solutions are possible for a string reconstruction problem with 13 words?
A published solution is not available for this question yet.
Question 314 MCQ · 1.0 marks
What is the number of 5-mers generated from the sequence : “AGATATATTATTGTCTTTTTTGTCA”?
20
22
15
21
A published solution is not available for this question yet.
Question 315 MCQ · 3.0 marks
What is the total number of nodes of the De-Bruijn Graph generated from the 3-mers obtained
from “TACTCTAAG”?
3
5
7
4
A published solution is not available for this question yet.
Question 316 MCQ · 3.0 marks
Given the two sequences “GATTACA”, “GTCGACGCA”, and the scoring paradigm: matches: “+1”,
mismatches: “-1” and gap: “-2”, find the final score for the best global alignment between the two
sequences.
10
-11
-3
2
A published solution is not available for this question yet.
Question 317 MCQ · 3.0 marks
Given the k-mers : ’GCCGT’, ’CGTAG’, ’TAGGC’, ’GTAGG’, ’CTATG’, ’CCGTA’, ’TATGC’, ’TGCCG’, ’AGGCG’,
’ATGCC’, reconstruct the sequence from which the k-mers were generated.
CTATACCGTAGGCG
CTATGCCGTAGGCG
ATCGGTACAACGG
TATGCCGTAGGCGC
A published solution is not available for this question yet.