bt4002_2026T1_Q2_NA.pdf

Big Data and Biological Networks · Quiz 2 · Jan 2026

Questions and published explanations below are available without starting a test. Some questions may not have a published solution yet.

Question 2 MCQ · 1.0 marks

If currency metabolites like ATP and NADH are not removed from a substrate graph, shortest path analysis between two metabolite nodes will likely:

Overestimate path lengths due to the presence of many edges
Underestimate path length due to artificial shortcuts
Fail to compute paths
Give identical results

A published solution is not available for this question yet.

Question 3 MCQ · 1.0 marks

What is the reason for the stuck reactions getting relieved in a microbial community?

New genes appear in the organisms
Reaction stoichiometry changes
Enzymes are removed from the organisms
Metabolites can be exchanged between organisms

A published solution is not available for this question yet.

Question 4 MCQ · 1.0 marks

In a community, organism A relieves 5 stuck reactions in organism B, and organism B relieves 5 stuck reactions in organism A. Which of the following is true?

MSI(A) = MSI(B)
MSI(A) > MSI(B)
MSI(A) < MSI(B)
MSI(A) and MSI(B) cannot be determined without knowing the initial number of stuck reactions

A published solution is not available for this question yet.

Question 5 MCQ · 1.0 marks

In a disease-spread bipartite network model with people and locations as nodes, what do the two projections of the bipartite network represent?

Vaccination and quarantine networks
People-people interactions and location-location interaction networks
Susceptible-infected and infected-recovered populations
Disease-disease networks in different populations

A published solution is not available for this question yet.

Question 6 MCQ · 1.0 marks

A scale-free network has a characteristic path length of L = 3.5. After a targeted attack on the single highest-degree hub, L jumps to 8.2. If a random node was removed instead, what is the most likely new value for L?

8.2
15.0
3.6
1.2

A published solution is not available for this question yet.

Question 7 MCQ · 1.0 marks

If a metabolite acting as a global “hub” in a metabolic network is knocked out, the most likely immediate consequence is:

A decrease in the pairwise disconnectivity index.
The fragmentation of metabolic pathways, potentially disrupting essential functions.
A significant increase in the network's resilience.
No change, as metabolic networks always have alternative redundant routes.

A published solution is not available for this question yet.

Question 8 MCQ · 1.0 marks

In a hierarchical agglomerative clustering process, what happens at the very final step?

Every point remains in its own individual cluster.
The network is split into two factions like the Karate Club.
All nodes are coalesced into a single, massive cluster.
The betweenness centrality of all edges becomes equal.

A published solution is not available for this question yet.

Question 9 MCQ · 1.0 marks

What is the primary reason for using Erdős–Rényi graph when identifying network motifs?

To determine if the characteristic path length is significantly larger than would be expected by chance
To demonstrate that the network’s robustness to random failure is significantly higher than would be expected by chance
To ensure that the network possesses a significantly higher density than would be expected by chance
To determine if a specific pattern occurs significantly more than would be expected by chance

A published solution is not available for this question yet.

Question 10 MCQ · 1.0 marks

In a Gene Regulatory Network (GRN) with [[IMAGE:5aba2126fc50a30e_4_2]] genes where self-regulation of genes is allowed, the number of possible directed interactions is:

[[IMAGE:5aba2126fc50a30e_4_3]]
[[IMAGE:5aba2126fc50a30e_4_4]]
[[IMAGE:5aba2126fc50a30e_4_5]]
[[IMAGE:5aba2126fc50a30e_4_6]]

A published solution is not available for this question yet.

Question 11 MCQ · 1.0 marks

Which of the following cannot be a node in signalling network?

Ligands
Receptors
Transcription factors
Enzymes

A published solution is not available for this question yet.

Question 12 MCQ · 1.0 marks

How many solutions are possible for a string reconstruction problem with 10 words?

[[IMAGE:5aba2126fc50a30e_5_7]]
[[IMAGE:5aba2126fc50a30e_5_8]]
[[IMAGE:5aba2126fc50a30e_5_9]]
[[IMAGE:5aba2126fc50a30e_5_10]]

A published solution is not available for this question yet.

Question 13 MCQ · 1.0 marks

What is the number of 3-mers generated from the sequence : CAAACTACCACGGATACACCACTTGG?

A published solution is not available for this question yet.

Question 14 MCQ · 2.0 marks

What is the average degree (regardless of the direction) of the 3-mer overlap graph constructed from “CAAACTA”?

A published solution is not available for this question yet.

Question 15 MCQ · 2.0 marks

What is the total number of edges of the De-Bruijn Graph generated from the 3-mers obtained from “CAAACTACCACG”?

A published solution is not available for this question yet.

Question 16 MCQ · 2.0 marks

What is the total number of nodes of the Overlap Graph generated from the 4-mers obtained from “CAAACTACCACGGATACA”?

A published solution is not available for this question yet.

Question 17 MCQ · 3.0 marks

Given the two sequences “AGAGCTTA”, “AAGAGTTGA”, and the scoring paradigm: matches: “ [[IMAGE:5aba2126fc50a30e_6_11]] ”, mismatches: “ [[IMAGE:5aba2126fc50a30e_7_12]] ” and gap: “ [[IMAGE:5aba2126fc50a30e_7_13]] ”, find the final score for the best global alignment between the two sequences.

A published solution is not available for this question yet.

Question 18 MCQ · 3.0 marks

Given the k-mers : ’CAAA’, ’AACT’, ’AAAC’, ’ACTA’, ’CTAC’, ’TACC’, ’ACCA’, ’CCAC’, ’CACG’, ’CGGA’, ’ACGG’, ’GGAT’, ’GATA’, ’TACA’, ’ATAC’, ’ACAC’, ’CACC’, reconstruct the sequence from which the k-mers were generated.

CAAACTACCACGGATACAGC
CTATGCCGTAGGCGGTACTAA
ATCGGTACAACGGTTA
CAAACTACCACGGATACACC

A published solution is not available for this question yet.

Question 19 MCQ · 3.0 marks

Consider the following two statements: **Statement 1**: Reads from the genome sequencing are prone to error. **Statement 2**: Sequence alignment can be used to overcome this problem. Based on your observations, which of the following statements is true?

Both statements are true and statement 2 is a potential solution for statement 1
Both statements are true but statement 2 is not a solution to statement 1
Both statements are false
Statement 1 is false but Statement 2 is true

A published solution is not available for this question yet.

Question 20 MSQ · 2.0 marks

Considering a metabolic system with 50 metabolites and 120 reactions, which of the following statements are correct?

The corresponding substrate graph will contain 50 nodes and 120 edges
The corresponding reaction graph will contain 120 nodes and 120 edges
The corresponding bipartite graph will contain 170 nodes
The corresponding substrate graph will contain 50 nodes

A published solution is not available for this question yet.

Question 21 MSQ · 2.0 marks

In a community of two organisms, A and B, what are the possible scenarios in which Metabolic Support Index (MSI) will be 0 for organism A?

All stuck reactions in A are relieved in the presence of B
All stuck reactions in B are relieved in the presence of A
Number of stuck reactions in A remains unchanged in the presence of B
No stuck reactions are present in A initially
No metabolites are exchanged between organisms

A published solution is not available for this question yet.

Question 22 MSQ · 2.0 marks

Two genes A and B belong to two different metabolic pathways producing the same essential metabolite. Removing either of these genes separately does not affect cell survival but deleting them together leads to cell death. Which of the following are true:

Gene products of A and B interact physically
Genes A and B must be located adjacent to each other in the genome
Both genes compensate for each other
There is redundancy in the metabolic pathway

A published solution is not available for this question yet.

Question 23 MSQ · 2.0 marks

Consider the following network and identify the possible gene regulatory interactions: (arrows in the option indicates a directed interaction) [[IMAGE:5aba2126fc50a30e_9_14]]

Gene 1 → Gene 2
Gene 1 → Gene 3
Gene 3 → Gene 2
Gene 2 → Gene 3

A published solution is not available for this question yet.

Question 24 MSQ · 2.0 marks

We have a graph that was constructed by comparing n DNA sequences. If the two sequences can be aligned with a score greater than a threshold value, we assign an edge between the two in the graph. Given this, which of the following are true:

Inserting a new node to the graph requires n comparisons
Inserting a new node is a node level task
If all the alignments have the same score, the resultant graph is a complete graph
There will be two connected components in the resultant graph

A published solution is not available for this question yet.

Question 25 MSQ · 2.0 marks

Which of the following makes appropriate pairs?

Node classification – Predicting drug-drug interaction
Graph classification – Predicting toxicity of a chemical compound
Link Prediction – Predicting function of novel proteins
Graph regression – Predicting free energy of hydration

A published solution is not available for this question yet.

Question 26 MSQ · 3.0 marks

Which of these are challenges one might encounter in the process of genome assembly?

Erroneous reads
Large volumes of data
Duplicate sequences
Incomplete graph

A published solution is not available for this question yet.

Question 27 MCQ · 2.0 marks

Consider an adjacency matrix of 7-node network. Nodes are indexed as N1 to N7. A value of 1 indicates an edge, and 0 indicates no direct edge. [[IMAGE:5aba2126fc50a30e_10_15]] Based on the above data, answer the given subquestions.

In similarity-based clustering (e.g., Jaccard or Cosine similarity), why are nodes N1, N4, and N5 most likely to be grouped into the same cluster?

They have the lowest degree centrality in the network.
They share a high number of common neighbors (Nodes N2 and N3) and are directly connected.
They are "bridge" nodes (high betweenness) connecting N6 and N7 to the rest of the graph.
They are isolated from the rest of the network's path redundancy.

A published solution is not available for this question yet.

Question 28 MCQ · 2.0 marks

To find the number of paths of **length 2** between Node N1 and Node N4, which mathematical operation should a student perform on the matrix provided?

Calculate the Eigenvector Centrality of the adjacency matrix.
Look at the value at index (1, 4) of the squared adjacency matrix ( [[IMAGE:5aba2126fc50a30e_11_16]] ).
Sum the total number of 1s in the first row.
Identify the shortest path using the Girvan-Newman algorithm.

A published solution is not available for this question yet.

Question 29 MCQ · 2.0 marks

If you wanted to partition this network into two communities using the Girvan-Newman algorithm, which edge would be the first to be removed?

Edge (N1,N5)
Edge (N4,N5)
Edge (N6,N7)
Edge (N5,N6)

A published solution is not available for this question yet.

Question 30 MCQ · 2.0 marks

After applying the Girvan-Newman algorithm for the first necessary edge removal, what is the most appropriate property of the largest resulting component?

Sparsely connected component
Component consists of 10 edges
Component forms a clique
Component consists of 7 nodes

A published solution is not available for this question yet.